UTR Designer

UTR Designer

Reverse Engineering

Predict the expression level from input sequence

Forward Engineering

Cluster: 4641 jobs have been done.
Design the 5'-UTR sequences and coding sequences (optional) which has a desired expression level

Constraints for designing 5'-UTR sequence (25NT) : ( Default: NNNNNNNNNNAAAGGAGCATCNNNN ) see IUPAC
Protein Coding Sequence (at least N-term 35NT) : ( ATGGCTAGCAAGGGCGAGGAGCTGTTCACCGGGGT ... )
16s rRNA Sequence (5' -> 3') : ( Default: E.coli DH10B; ACCUCCUUA # 5' -> 3' )
Desired Expression Level : ( 102672.55, ... )

Reoptimize Codon Contents? (same codon preference) :
E-mail (Optional) :

Reference

Please, cite our paper : http://dx.doi.org/10.1016/j.ymben.2012.10.006

CORRESPONDENCE

Sanguk Kim, sukim at postech.ac.kr Gyoo-Yeol Jung, gyjung at postech.ac.kr