UTR Designer

Reverse Engineering

Predict the expression level from input sequence

( GTTTCCACTCAAAGGAGCATCTTAC )
( ATGGCTAGCAAGGGCGAGGAGCTGTTCACCGGGGT ... )
( Default: E.coli DH10B; ACCUCCUUA # 5' -> 3' )

Forward Engineering

Cluster: 7935 jobs have been done.
Design the 5'-UTR sequences and coding sequences (optional) which has a desired expression level

( Default: NNNNNNNNNNAAAGGAGCATCNNNN ) see IUPAC
( ATGGCTAGCAAGGGCGAGGAGCTGTTCACCGGGGT ... )
( Default: E.coli DH10B; ACCUCCUUA # 5' -> 3' )
( 102672.55, ... )

Reference

Please, cite our paper : http://dx.doi.org/10.1016/j.ymben.2012.10.006

CORRESPONDENCE

Sanguk Kim, sukim at postech.ac.kr
Gyoo-Yeol Jung, gyjung at postech.ac.kr