UTR Library Designer Error

Template 5'-UTR Sequence (25NT) : NNNNNNNNNNAAAGGAGCATCNNNN ,     Additional Constraints for designing 5'-UTR sequence (25NT) : NNNNNNNNNNNNNNNNNNNNNNNNN

Protein Coding Sequence (at least N-term 35NT) : ATGAGTTTTGATATTGCCAAATACCCGACCCTGGC

16s rRNA Sequence : ACCUCCUUA

Desired Expression Range : 0.00 ~ 10000.00 ( Desired min expression should be bigger than 1 )

Resolution : 32