|
UTR Library Designer Error Template 5'-UTR Sequence (25NT) : AAAATTTAGTTGGTAACAACAAATG , Additional Constraints for designing 5'-UTR sequence (25NT) : AAAATTTNNNNNGTAACAACAAATG Protein Coding Sequence (at least N-term 35NT) : ATG ( Length should be more than 35NT ) 16s rRNA Sequence : ACCUCCUUA Desired Expression Range : 1000000.00 ~ 102672.55 ( Desired max expression should be larger than that of min ) Number of expression-level intermediates : 16 |