UTR Library Designer

UTR Library Designer

UTR Library Designer

Cluster: 1181 jobs now running. [Show List]
561 jobs waiting for run.
4757 jobs have been done.

Design the 5'-UTR sequence and coding sequences (optional) which can generate various expression levels between a desired max and min expression level

Template 5'-UTR sequence (25NT) :	( NNNNNNNNNNAAAGGAGCATCNNNN, GTTTCCACTCAAAGGAGCATCCTAC )
Additional Constraints for designing 5'-UTR sequence (25NT) :	( NNNNNNNNNNNNNNNNNNNNNNNNN, YYYYYYYYYYAAAGGAGCATCYYYY ... ) see IUPAC
Protein Coding Sequence (at least N-term 35NT) :	( ATGGCTAGCAAGGGCGAGGAGCTGTTCACCGGGGT ... ; should start with ATG or GTG )
16s rRNA Sequence (5' -> 3') :	( Default: E.coli DH10B; ACCUCCUUA # 5' -> 3' )
Desired Max Expression Level :	( 102672.55; should be less than 1000000 )
Desired Min Expression Level :	( 1002.55; should be more than 1 )
Number of expression-level intermediates :
Reoptimize Codon Contents? (same codon preference) :
E-mail (Optional) :

Reference

Please, cite our paper : Seo et. al., Predictive combinatorial design of mRNA translation initiation regions for systematic optimization of gene expression levels, Sci. Rep. 2014

CORRESPONDENCE

Sanguk Kim, sukim at postech.ac.kr Gyoo-Yeol Jung, gyjung at postech.ac.kr