UTR Library Designer

UTR Library Designer

Cluster: 429 jobs now running. [Show List]
             7 jobs waiting for run.
             1824 jobs have been done.

Design the 5'-UTR sequence and coding sequences (optional) which can generate various expression levels between a desired max and min expression level

( NNNNNNNNNNAAAGGAGCATCNNNN, GTTTCCACTCAAAGGAGCATCCTAC )
( NNNNNNNNNNNNNNNNNNNNNNNNN, YYYYYYYYYYAAAGGAGCATCYYYY ... ) see IUPAC
( ATGGCTAGCAAGGGCGAGGAGCTGTTCACCGGGGT ... ; should start with ATG or GTG )
( Default: E.coli DH10B; ACCUCCUUA # 5' -> 3' )
( 102672.55; should be less than 1000000 )
( 1002.55; should be more than 1 )

Reference

Please, cite our paper : Seo et. al., Predictive combinatorial design of mRNA translation initiation regions for systematic optimization of gene expression levels, Sci. Rep. 2014

CORRESPONDENCE

Sanguk Kim, sukim at postech.ac.kr
Gyoo-Yeol Jung, gyjung at postech.ac.kr